Resources
CMMT Welcome tips As a new member, this document is here to help you get all set-up in this new environment, new workplace, new city! https://docs.google.com/document/d/1p1IP-ZxeeQNhvaPnB3dCuJ4iTX2r85t97ujSwWmFv7k/edit?usp=sharing
Monthly CMM Talks
Here is a list of all posts categorized “CMM Talks”
Meet the Trainee Committee
The CMMT Trainee committee organizes scientific and social events to increase networking between CMMT members and represent the interests of CMMT trainees to CMMT faculty. The goal of the committee is to initiate cross talk between the various labs at CMMT, ignite friendships, and create a nurturing scientific community for both new and established members […]
Simpson Lab paper in Nature’s Gene Therapy
Read the new paper from the Simpson lab in Nature’s Gene Therapy: Human MiniPromoters for ocular-rAAV expression in ON bipolar, cone, corneal, endothelial, Müller glial, and PAX6 cells, here: https://rdcu.be/ceDDL
Virtual: CMMT 2021 Spring Symposium
Thursday, March 4, 2021 | 10:00 – 11:30 am Join trainees from the UBC Centre for Molecular Medicine & Therapeutics (CMMT) to learn more about genetic research and the translation of basic knowledge into new therapies. Trainees will demo a lab experiment, talk about their personal journey into science, talk about what drew them to UBC, talk about challenges […]
Gairdner Highschool Symposium: Trainee Event
The Gairdner High School Symposium is a half-day event held each fall that gives secondary students and teachers the opportunity to hear from Gairdner award-winning scientists and attend a behind-the-scenes tour of BC Children’s Hospital’s research facilities. This event is hosted in conjunction with the Center for Molecular Medicine and Therapeutics (CMMT) and the Canada Gairdner Foundation, recognizing the world’s most creative and […]
2020 Gairdner Highschool Symposium: Morgan Towriss – Mental Health
This is the recording of the Morgan Towriss, Honours Thesis Student – Jan Lab. Please enter any questions you may have for Morgan below and we will get back to you as soon as we can.
2020 Gairdner Highschool Symposium: Vaishnavi Sridhar – Cells
This is the recording of the Vaishnavi Sridhar, PhD Student – Conibear Lab. Please enter any questions you may have for Vaishnavi below and we will get back to you as soon as we can.
CMMT Newsletter January 2021
Bruce’s message Happy new year all! I hope everyone had a restful holiday season and was able to connect with family and friends in some way, even if not in person. Like all of you, I am glad to see 2020 in the rear-view mirror and am looking forward to a much more productive and […]
Virtual: 2020 Vancouver Gairdner National Symposium
Watch the video of the 2020 Gairdner National Symposium: HERE The Vancouver Gairdner High School & National Symposium is held each fall to give students, teachers, and the academic community the opportunity to hear from two Gairdner award-winning scientists and learn about the BC Children’s Hospital’s research facilities. Time: 2:00- 4:30 pm, Monday, October 26, […]
Dr. Wyeth Wasserman among four UBC faculty named AAAS Fellows in 2020
This year, four UBC faculty members have been elected as Fellows of the American Association for the Advancement of Science (AAAS), the world’s largest multidisciplinary scientific society and publisher of the Science family of journals. Jesse Brewer (Physics): For his pioneering work developing muSR, in which muons are used to probe quantum materials, with critical […]
Re-writing the code of life: GenomeBC podcast
Two scientists recently shared the Nobel Prize for Chemistry for transforming an obscure bacterial immune mechanism, called CRISPR, into “genetic scissors” – an editing tool for re-writing the code of life. The two female Nobel Prize winners accomplished this through collaboration – which is exactly how two Canadian scientists – Dr. Elizabeth Simpson (CMMT) and […]
CMMT Newsletter September 2020
Changing the World: It Pays to Dream In 1983, Dr. Michael Hayden arrived at the University of British Columbia (UBC) with a big idea, some might even say a dream. A physician-scientist with a focus on genetic diseases, particularly Huntington’s Disease and lipoprotein disorders, Dr. Hayden sought to establish a research centre that embraced an […]
New antivirus options from UBC IT
As of 2020 July, UBC IT has mandated a changeover in cyber security/anti malware software. Here is what you need to know: Your on-site desktop computers that log in with CMMT network credentials will be handled by CMMT IT Your UBC-owned laptops will need you to do the following – Uninstall SOPHOS (see section below) […]
Hayden Publication Supplemental Materials
Publication Comment/Notes Download Link A new model for prediction of the age of onset and penetrance for Huntington’s disease based on CAG length N/A pdf_hayden_supplementary_tablesDownload
Job Seekers
CMMT is a thriving learning environment built on excellence and collegial relationships. Our people and culture are one of the most important reasons for our success. If you are interested in joining this high calibre, energetic, and enthusiastic team, contact us. Current Openings: Getting Involved The Centre for Molecular Medicine and Therapeutics exists and succeeds […]
Verchere Lab
In diabetes mellitus the pancreas’ insulin-producing beta cells have impaired function or are destroyed, resulting in deficient insulin secretion. This leads to high blood glucose levels and later complications, including kidney disease and blindness. In type 1 (juvenile onset) diabetes the patient’s own immune system kills the beta cells. In type 2 (adult onset) diabetes, […]
20 Year Service Awards
Dr. Bruce Verchere, Director presenting 20-year service awards to Dora Pak, Wasserman Lab Research Manager, Yanbo Yan, Technician, Transgenic Facility, and William Yue, Stores Manager.
Dr. Elizabeth Simpson Awarded Fighting Blindness Research Grant
Using gene therapy to treat congenital blindness Aniridia is an eye disorder where the iris, the coloured part of the eye, is partially or completely absent. Individuals with aniridia usually have low vision from birth and develop glaucoma and cataracts, which can lead to blindness. Current treatments may slow the progression of aniridia, but there […]
Leadership Update: Bruce Verchere appointed Director, Centre for Molecular Medicine and Therapeutics
Dear Colleagues, It is with great pleasure that we announce the appointment of Dr. Bruce Verchere as the Director of the Centre for Molecular Medicine and Therapeutics (CMMT). Dr. Verchere is a highly accomplished researcher and Professor in the Departments of Pathology and […]
2019 International Gairdner Symposium
The Gairdner International Symposium is held each fall to give students, teachers, and researchers the opportunity to hear from Gairdner award-winning scientists and attend a luncheon with the award winners. Watch the video of the 2019 Gairdner High School Symposium: HERE Watch the video of the 2019 Gairdner National Symposium: HERE Time: 3:30- 6:00 pm, Monday, October 21, 2019 […]
CMMT researchers mining 25 years of data uncovers a new predictor of age of onset for Huntington disease
May 16, 2019 Study lead author Galen Wright Investigators at the University of British Columbia (UBC) Centre for Molecular Medicine & Therapeutics (CMMT) and BC Children’s Hospital have examined more than 25 years of data to reveal new insights into predicting the age of onset for Huntington disease. “This discovery may enable us to provide […]
Huntington drug successfully lowers levels of disease-causing protein
An international clinical trial has found that a new drug for Huntington disease is safe, and that treatment with the drug successfully lowers levels of the abnormal protein that causes the debilitating disease in patients. In the study published today in the New England Journal of Medicine, researchers from UBC and their colleagues have demonstrated […]
Huntingtin Lowering Strategies for Disease Modification in Huntington’s Disease
Huntington’s disease is caused by an abnormally expanded CAG repeat expansion in the HTT gene, which confers a predominant toxic gain of function in the mutant huntingtin (mHTT) protein. There are currently no disease-modifying therapies available, but approaches that target proximally in disease pathogenesis hold great promise. These include DNA-targeting techniques such as zinc-finger proteins, transcription activator-like effector nucleases, […]
Trainee Spotlight: Jeffy Rajan
Kudos to Jeffy Rajan, recipient of a 2019 Brain, Behaviour and Development (BB&D) Trainee Boost Award. Jeffy hangs out in the Goldowitz Lab and her project is “Impact of motor learning performance in Developmental Coordination Disorder (DCD)”. “I am very grateful to be the recipient of the BB&D Trainee Boost Award in recognition of a […]
Lowering levels of mutant protein that causes Huntington disease can restore cognitive function in mice
Lowering levels of mutant protein that causes Huntington disease can restore cognitive function in mice
2018 International Gairdner Symposium
The Gairdner High School Symposium is a half-day event held each fall that gives secondary students and teachers the opportunity to hear from Gairdner award-winning scientists and attend a behind-the-scenes tour of BC Children’s Hospital’s research facilities. Watch the video of the 2018 Gairdner High School Symposium: HERE Time: 3:30- 6:00 pm, Monday, October 22, 2018 Venue: LSC2, Life […]
Project Planning
MAPS is a great resource that is not only limited to transgenic work. We have helped researchers in a numbers of ways, including: Resource for Writing Grants Experimental Planning Breeding Strategies Test Figures for Grants Letters of Support Space to Run Experiments Description of Mutant Mouse Alleles Additional services include: DNA and ESC microinjection; ESC […]
Archive: Huntingtons Disease Prevalance
Note: the below is a port of an archived report preserved for the purpose of publication links. Huntington disease (HD) is a progressive neurodegenerative disorder that is dominantly inherited and results from a mutation that expands the polymorphic trinucleotide (CAG) tract in the huntingtin gene. The average CAG-tract size in the general population is 16–20 […]
Strict eating schedule can lower huntington disease protein in mice
Strict eating schedule can lower Huntington disease protein in mice
BC and UK partnership to tackle rare diseases through genomics
Vancouver, BC — A new partnership pilot project between Genome British Columbia (Genome BC) and Genomics England will focus on improving the diagnosis of rare diseases in children while furthering the discovery of new, novel diseases in BC and around the world. More than 80 per cent of the 7000 known rare diseases are genetic […]
‘Phenomenal’ trial results may lead to a treatment for Huntington’s disease, experts say
via the Washington Post: The discovery of a drug that may treat the fatal disease known as Huntington’s is being hailed as “historic” by Louise Vetter, president and CEO of the Huntington’s Disease Society of America, and “phenomenal” and “fantastically promising” by Huntington’s researchers, including the woman who discovered the genetic mutation that causes the disease. “I’m […]
Ionis Antisense Oligonuleotide Drug IONIS-HTTRX is Safe and Decreases Levels of Toxic Huntington’s Disease Protein in Cerebrospinal Fluid.
In a statement released today, Ionis Pharmaceuticals announced study results demonstrating for the first time that their drug (IONIS-HTTRX) lowered levels of the abnormal protein causing Huntington’s disease in cerebrospinal fluid, and that this approach was safe and well tolerated in humans. Link: http://ir.ionispharma.com/news-releases/news-release-details/ionis-pharmaceuticals-licenses-ionis-htt-rx-partner-following The IONIS-HTTRx Study: The IONIS-HTTRX trial enrolled 46 patients with […]
(Untitled)
Huntington Disease (HD) Biobank Huntington Disease Biobank at the University of British Columbia Blood and DNA Donation Further research is needed to develop more effective treatments for Huntington Disease (HD). The collection of DNA samples and medical information is important for this research. By making a donation of your blood and clinical information to the […]
Potential Breakthrough for Huntington’s Disease
Lancet, Neurology paper released “Neurofilament light protein in blood as a potential biomarker of neurodegeneration in Huntington’s disease: a retrospective cohort analysis”. Authors: Lauren M Byrne, MRes, Filipe B Rodrigues, MD, Prof Kaj Blennow, PhD, Prof Alexandra Durr, PhD, Prof Blair R Leavitt, PhD, Prof Raymund A C Roos, PhD, Rachael I Scahill, PhD, Prof […]
Pope embraces Huntington’s afflicted in bid to end stigma
http://www.ctvnews.ca/health/pope-embraces-huntington-s-afflicted-in-bid-to-end-stigma-1.3418951 VATICAN CITY — Pope Francis embraced weeping mothers, fathers and children with Huntington’s Disease on Thursday as he sought to remove the stigma of an incurable genetic disorder that causes such devastating physical and psychiatric effects that its sufferers are often shunned and abandoned. One by one, Francis blessed and greeted each of the […]
Dr. Michael R. Hayden Inducted into the Canadian Medical Hall of Fame
On Thursday, May 4th, six renowned medical pioneers will be recognized as the 2017 Canadian Medical Hall of Fame Inductees at a special ceremony in Québec City, hosted by Université Laval and its Faculty of Medicine and sponsored by the Canadian Medical Association and MD Financial Management. “The Canadian Medical Hall of Fame is proud […]
BC Children’s Hospital researchers & UBC students create their own e-textbook and new software platform
Undergraduate students in Dr. Wyeth Wasserman’s cancer genetics class had a unique assignment: to write their own e-textbook for their course. “Textbooks cost too much and students should have high quality, free materials,” says Dr. Wasserman, who led the project. He is executive director of BC Children’s Hospital Research Institute, professor in the Department of […]
Contact Dr. Wasserman
Principal Investigator: Wyeth Wasserman, PhD Room 3109, Wasserman Lab Centre for Molecular Medicine and Therapeutics 950 West 28th Avenue Vancouver, BC V5Z 4H4 Canada wyeth@cmmt.ubc.caPhone +1 (604) 875-3812 Fax +1 (604) 875-3840 http://www.cmmt.ubc.ca/wyethhttp://www.cisreg.ca/Twitter: @Wyeth Wasserman For administrative questions: Dora Pak Wasserman Lab/CMMT Room 3109 950 West 28th Avenue Vancouver BC V5Z 4H4 Canada dora@cmmt.ubc.caPhone […]
Standard DNA Sequencing Primers
Following is a list of Standard primers provided upon request. Function Sequence T7 promoter GTAATACGACTCACTATAGGG T7 terminator GCTAGTTATTGCTCAGCGG T3 CAATTAACCCTCACTAAAGG SP6 TACGATTTAGGTGACACTATAG -21M13 Forward TGTAAAACGACGGCCAGT M13 Reverse CAGGAAACAGCTATGAC BGH Reverse TAGAAGGCACAGTCGAGG PGEX Forward GGGCTGGCAAGCCACGTTTGGTG PGEX Reverse CCGGGAGCTGCATGTGTCAGAGG Custom DNA Oligo Synthesis Custom DNA oligo synthesis is now available through the IDT – CMMT Stores Web-Portal. […]
DNA Sequencing Protocol Notes
ABI 3500xl genetic analyzer information The facility DNA sequencing system was upgraded in January 2021 from the ABI 3130xl to the ABI 3500xl. Following is some information on the system: General ABI 3500xl information Protocols Sequencing reaction protocol for BigDye: BigDye Terminator v3.1 Cycle Sequencing Kit Protocol (Applied Biosystems protocol) Recommended DNA purification kits Qiagen […]
van Karnebeek Lab Research Projects
The research of Dr. van Karnebeek’s (MD, PhD in pediatrics and biochemical genetics) focuses on improving diagnosis and treatment of intellectual disability. Characterized by deficits in cognitive functioning and adaptive skills, intellectual disability is associated with significant behavioral problems including epilepsy and other neurological disabilities. Affecting 2-3% of children worldwide, its economic impact and emotional […]
Contact Dr. Taubert
Principal Investigator:: Stefan Taubert, PhD CMMT Room 2024 950 West 28th Avenue Vancouver BC V5Z 4H4 Canada taubert@cmmt.ubc.caPhone +1 (604) 875-3860 Fax +1 (604) 875-3819 http://www.cmmt.ubc.ca/taubert Twitter: @TaubertLab For administrative questions: Dora Pak CMMT Room 3109 950 West 28th Avenue Vancouver BC V5Z 4H4 Canada dora@cmmt.ubc.caPhone +1 (604) 875-2345 ext. 5273 Fax +1 (604) […]
Mostafavi Lab Research Projects
Research at the Mostafavi lab focuses on developing computational and statistical approaches for integrating and interpreting diverse types of genomics data, with the ultimate goal of disentangling meaningful molecular associations for common and complex pathologies, such as neurodegenerative and psychiatric disorders. 1. Network-based integration of heterogeneous genomics data to predict gene function: An unrealized goal […]
MAPS Services
CRISPR/Cas9 -Mediated Gene Editing in Mouse gene knock-out gene knock-in gene replacement (amino acid changes) epitope tagging, including fluorescent protein tagging conditional models DNA Microinjection for transgenic generation ESC Microinjection ESC Electroporation ESC and MEF Generation Mouse Sperm Cryopreservation Mouse Colony Management Project Planning For more information on our services please contact us at mapsinfo@cmmt.ubc.ca […]
MAPS Contact
FEES Fees are specific to the requirements of the individual project. Services offered are flexible and projects can be customized to meet individual needs. For project-based pricing please contact us at mapsinfo@cmmt.ubc.ca Contact Information Dr. Elizabeth M. Simpson Director +1 (604) 875-3830 mapsinfo@cmmt.ubc.ca For more information please contact: Michael Hockertz. Director of Core Facilities […]
Past Projects & Publications
Featured Projects: Conditional PDE Mouse Made for BC Children’s and Women’s Team Hayden Lab Cryopreservation HMMR Conditional Mouse Publication Leavitt Lab’s New Mouse MAPS Makes 3xFLAG Insertion with CRISPR/Cas9 MAPS Makes KO CRISPR Mouse for National University of Singapore MAPS Makes New CRISPRed Mouse for Ph.D. Student MAPS Plays Critical Role in Publication MAPS Makes Another […]
Mouse Embryonic Fibroblasts & Embryonic Stem Cells
One of the many services that MAPS provides is generating custom mouse embryonic fibroblasts (MEFs) and embryonic stem cells (ESCs) from your desired strain. MAPS is a start-to-finish service, helping with importation of mice, and undertaking all mouse and tissue culture work. Depending on your project needs, we can produce otherwise identical lines of MEFs […]
Mouse Strains Available
At all times MAPS is actively breeding three main colonies of mice: C57BL/6J CD-1 129S1/SvImJ From these three colonies we provide a number of services available right here in CMMT: Age specific mice or embryos Pseudo pregnant CD-1 recipients CD-1 foster mothers Timed pregnancies C57BL/6J primiparous females For more information on our services or to place an […]