Standard DNA Sequencing Primers

Following is a list of Standard primers provided upon request.

FunctionSequence
T7 promoterGTAATACGACTCACTATAGGG
T7 terminatorGCTAGTTATTGCTCAGCGG
T3CAATTAACCCTCACTAAAGG
SP6TACGATTTAGGTGACACTATAG
-21M13 ForwardTGTAAAACGACGGCCAGT
M13 ReverseCAGGAAACAGCTATGAC
BGH ReverseTAGAAGGCACAGTCGAGG
PGEX ForwardGGGCTGGCAAGCCACGTTTGGTG
PGEX ReverseCCGGGAGCTGCATGTGTCAGAGG

Custom DNA Oligo Synthesis

Custom DNA oligo synthesis is now available through the IDT – CMMT Stores Web-Portal. For information on this portal, please visit the CMMT/CFRI Stores webpage. To go directly to the portal click here: IDT – CMMT Stores Portal.

Return to DNA sequencing core facility main page.

Contact Information

For additional information and to submit samples please contact:

Ms. Liz Hui
(604) 875-3814
dna@cmmt.ubc.ca

Mailing Address:

CMMT/BCCHR DNA Sequencing Core Facility
Attention: Ms. Liz Hui
The Centre for Molecular Medicine and Therapeutics
950 West 28th Avenue, Room A3-193
Vancouver, BC
V5Z 4H4 Canada

For further information on CMMT Core Facilities, please contact:

Michael Hockertz
hockertz@cmmt.ubc.ca
(604) 875-3816